Review



cccatcctcttccctattaag  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc cccatcctcttccctattaag
    Cccatcctcttccctattaag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cccatcctcttccctattaag/pRET%2EIL+(No+IRES-EGFP)+(Plasmid+%231832)/pmc05322258-93-23-9
    Average 90 stars, based on 2 article reviews
    cccatcctcttccctattaag - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Protein arginine methyltransferase 5 functions as an epigenetic activator of the androgen receptor to promote prostate cancer cell growth
    Article Snippet: .. The pLKO-Tet-On plasmid for expressing shRNA was obtained from Addgene (Cambridge, MA, USA), and the two shRNA sequences that target 5′-GCCCAGTTTGAGATGCCTTAT-3′ (#1577) and 5′-CCCATCCTCTTCCCTATTAAG-3′ (#1832) for PRMT5 knockdown and that target 5′-CCACTCCTTCAGCCCTTATTA-3′ (#2310) for Sp1 knockdown were selected for constructing pLKO-Tet-On-shPRMT5 and pLKO-Tet-On-shSp1 as described previously. ..

    Expressing:

    Article Title: Protein arginine methyltransferase 5 functions as an epigenetic activator of the androgen receptor to promote prostate cancer cell growth
    Article Snippet: .. The pLKO-Tet-On plasmid for expressing shRNA was obtained from Addgene (Cambridge, MA, USA), and the two shRNA sequences that target 5′-GCCCAGTTTGAGATGCCTTAT-3′ (#1577) and 5′-CCCATCCTCTTCCCTATTAAG-3′ (#1832) for PRMT5 knockdown and that target 5′-CCACTCCTTCAGCCCTTATTA-3′ (#2310) for Sp1 knockdown were selected for constructing pLKO-Tet-On-shPRMT5 and pLKO-Tet-On-shSp1 as described previously. ..

    shRNA:

    Article Title: Protein arginine methyltransferase 5 functions as an epigenetic activator of the androgen receptor to promote prostate cancer cell growth
    Article Snippet: .. The pLKO-Tet-On plasmid for expressing shRNA was obtained from Addgene (Cambridge, MA, USA), and the two shRNA sequences that target 5′-GCCCAGTTTGAGATGCCTTAT-3′ (#1577) and 5′-CCCATCCTCTTCCCTATTAAG-3′ (#1832) for PRMT5 knockdown and that target 5′-CCACTCCTTCAGCCCTTATTA-3′ (#2310) for Sp1 knockdown were selected for constructing pLKO-Tet-On-shPRMT5 and pLKO-Tet-On-shSp1 as described previously. ..

    Knockdown:

    Article Title: Protein arginine methyltransferase 5 functions as an epigenetic activator of the androgen receptor to promote prostate cancer cell growth
    Article Snippet: .. The pLKO-Tet-On plasmid for expressing shRNA was obtained from Addgene (Cambridge, MA, USA), and the two shRNA sequences that target 5′-GCCCAGTTTGAGATGCCTTAT-3′ (#1577) and 5′-CCCATCCTCTTCCCTATTAAG-3′ (#1832) for PRMT5 knockdown and that target 5′-CCACTCCTTCAGCCCTTATTA-3′ (#2310) for Sp1 knockdown were selected for constructing pLKO-Tet-On-shPRMT5 and pLKO-Tet-On-shSp1 as described previously. ..



    Similar Products

    shprmt5-2 (clone id: trcn0000303447, target sequence cccatcctcttccctattaag)  (Millipore)
    90
    Millipore shprmt5-2 (clone id: trcn0000303447, target sequence cccatcctcttccctattaag)
    RORα is symmetrically dimethylated and stabilized by PRMT5. ( a , b ) Increased arginine symmetric dimethylation of RORα in PRMT5-expressing cells immunoprecipitated using anti-Flag antibody; immunoprecipitated anti-symmetric dimethyl-arginine (SDMA) antibody. ( c ) DBD domain of RORα was symmetrically dimethylated by PRMT5. ( d , e ) Analysis of RORα protein degradation in control, PRMT5, and <t>shPRMT5-transfected</t> HEK293FT cells with cycloheximide (CHX, 100 μM) treatment. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test.
    Shprmt5 2 (Clone Id: Trcn0000303447, Target Sequence Cccatcctcttccctattaag), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cccatcctcttccctattaag/shprmt5+2++clone+id++trcn0000303447++target+sequence+cccatcctcttccctattaag+/pmc11120602-42-12-22
    Average 90 stars, based on 1 article reviews
    shprmt5-2 (clone id: trcn0000303447, target sequence cccatcctcttccctattaag) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    cccatcctcttccctattaag  (Addgene inc)
    90
    Addgene inc cccatcctcttccctattaag
    RORα is symmetrically dimethylated and stabilized by PRMT5. ( a , b ) Increased arginine symmetric dimethylation of RORα in PRMT5-expressing cells immunoprecipitated using anti-Flag antibody; immunoprecipitated anti-symmetric dimethyl-arginine (SDMA) antibody. ( c ) DBD domain of RORα was symmetrically dimethylated by PRMT5. ( d , e ) Analysis of RORα protein degradation in control, PRMT5, and <t>shPRMT5-transfected</t> HEK293FT cells with cycloheximide (CHX, 100 μM) treatment. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test.
    Cccatcctcttccctattaag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cccatcctcttccctattaag/pRET%2EIL+(No+IRES-EGFP)+(Plasmid+%231832)/pmc05322258-93-23-9
    Average 90 stars, based on 1 article reviews
    cccatcctcttccctattaag - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    RORα is symmetrically dimethylated and stabilized by PRMT5. ( a , b ) Increased arginine symmetric dimethylation of RORα in PRMT5-expressing cells immunoprecipitated using anti-Flag antibody; immunoprecipitated anti-symmetric dimethyl-arginine (SDMA) antibody. ( c ) DBD domain of RORα was symmetrically dimethylated by PRMT5. ( d , e ) Analysis of RORα protein degradation in control, PRMT5, and shPRMT5-transfected HEK293FT cells with cycloheximide (CHX, 100 μM) treatment. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test.

    Journal: Cancers

    Article Title: Regulation of RORα Stability through PRMT5-Dependent Symmetric Dimethylation

    doi: 10.3390/cancers16101914

    Figure Lengend Snippet: RORα is symmetrically dimethylated and stabilized by PRMT5. ( a , b ) Increased arginine symmetric dimethylation of RORα in PRMT5-expressing cells immunoprecipitated using anti-Flag antibody; immunoprecipitated anti-symmetric dimethyl-arginine (SDMA) antibody. ( c ) DBD domain of RORα was symmetrically dimethylated by PRMT5. ( d , e ) Analysis of RORα protein degradation in control, PRMT5, and shPRMT5-transfected HEK293FT cells with cycloheximide (CHX, 100 μM) treatment. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test.

    Article Snippet: Two PRMT5 knockdown plasmids, shPRMT5-1 (clone ID: TRCN0000303446, target sequence GGCTCAAGCCACCAATCTATG) and shPRMT5-2 (clone ID: TRCN0000303447, target sequence CCCATCCTCTTCCCTATTAAG), were purchased from Sigma.

    Techniques: Expressing, Immunoprecipitation, Transfection

    Silencing PRMT5 decreases RORα and promotes EMT. ( a ) PRMT5 knockdown was confirmed by RT-PCR; ( b ) PRMT5 knockdown was confirmed by Western blotting; ( c ) SNAI mRNA levels were increased in PRMT5-silenced MCF10A cells. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test. ( d ) Phase contrast images of control and two PRMT5-knockdown MCF10A cell lines (shPRMT5-1 and shPRMT5-2) in 2D and 3D cultures. Bar: 50 µm; ( e ) EMT marker proteins were examined in control and PRMT5-silenced MCF10A cells.

    Journal: Cancers

    Article Title: Regulation of RORα Stability through PRMT5-Dependent Symmetric Dimethylation

    doi: 10.3390/cancers16101914

    Figure Lengend Snippet: Silencing PRMT5 decreases RORα and promotes EMT. ( a ) PRMT5 knockdown was confirmed by RT-PCR; ( b ) PRMT5 knockdown was confirmed by Western blotting; ( c ) SNAI mRNA levels were increased in PRMT5-silenced MCF10A cells. Results are presented as mean ± SEM; n = 3. * p < 0.05, independent Student’s t -test. ( d ) Phase contrast images of control and two PRMT5-knockdown MCF10A cell lines (shPRMT5-1 and shPRMT5-2) in 2D and 3D cultures. Bar: 50 µm; ( e ) EMT marker proteins were examined in control and PRMT5-silenced MCF10A cells.

    Article Snippet: Two PRMT5 knockdown plasmids, shPRMT5-1 (clone ID: TRCN0000303446, target sequence GGCTCAAGCCACCAATCTATG) and shPRMT5-2 (clone ID: TRCN0000303447, target sequence CCCATCCTCTTCCCTATTAAG), were purchased from Sigma.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Marker